gervasio3027 gervasio3027
  • 03-03-2021
  • Chemistry
contestada

Is this statement true or false? A change in temperature is always an indicator of a chemical reaction.

Respuesta :

barackodam barackodam
  • 04-03-2021

Answer:

Explanation:

Absolutely true

Answer Link

Otras preguntas

What can we learn from violence and religion during the Baroque Era that can help reduce the amount of violence committed in the name of religion?
What type of interest rates will a person with a credit score in the low to below 600 range be offered for a loan? A. zero interest rates B. will never get a lo
Look at the text below. If there is an error with subject-verb agreement, select the incorrect verb and type it correctly. Otherwise, submit the text without ma
Halimbawa ng aspektong pangpulitikal
Pastor la ves dos giger lu ves
Suppose that the function fis defined, for all real numbers, as follows. f(x) -2 if x #2 4 if x=2 Find f(-1), f(2), and f(5). f (-1) f(2) f(5)
Which of the following features is found in the view tab of the paint window?A. cropB. zoomC. selectD. resize​
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
A simple random sample from a population with a normal distribution of 104 body temperatures has x=98.30°F and s=0.63°F. Construct an 80% confidence interval e
help, please the question in the picture