jayy33 jayy33
  • 14-11-2016
  • Biology
contestada

where does pollination and fertilization occur

Respuesta :

jcole615
jcole615 jcole615
  • 17-11-2016
pollination is when pollen is taken of the anthor and placed on a stigma the long thing in the middle of a flower. the pollen then goes down to the eggs and fertilizes them. it is basically the plant version of sperm meets egg. that edd eventually turns into a seed
Answer Link

Otras preguntas

Factor the expression: 16x^2 - 16xy^3 + 4y^6
Mimicry is an resemblance between an organism and another object and they advantages are???
-1/2+2/5 in simplest form
7) Suppose AVC = $113 when the firm produces 515 units of output. Then the firm's fixed cost amounts to a) $5,500, and its profit amounts to $20,375. b) $5,980,
A certain type of bacteria, given favorable growth medium, quadruples in population every 6 hours. Given that there were 150 bacteria to start with, how many ba
z varies directly with x and inversly with y^2 what is the value of z when x=4 and y=9
4. Why do you think President Gerald Ford referred to the human rights agreement in the Helsinki Final Act as “a time bomb” for the Soviet Union?
Find all real square roots of -121.
What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
how to conduct energy without the sun into a flashlight, need for invention help right now