cmf15
cmf15 cmf15
  • 14-11-2016
  • Mathematics
contestada

simplify
2a²b x 3a³b

Respuesta :

samanthamarie456 samanthamarie456
  • 14-11-2016
6a^5b x 3a^3b   the little arrows before the number resembles the exponet.
Answer Link

Otras preguntas

what is the final product? ^5sqrt4x^2 ^5sqrt4x^2
A string of lights contains three lights. the lights are wired in series, so that if any light fails the whole string will go dark. each light has probability .
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What is true concerning an ecological community? it is a large region of multiple organisms the boundaries, large or small, of a single organism the ecosystem o
Which of the following Platonic solids is also a cube? a) lcosahedron b) hexahedron c) octahedron d) tetrahedron e) dodecahedron f) none of these
Questions 1–10: Identify each redundant expression. Some sentences contain no redundancies. 1. Weather conditions forced the regional managers to postpone thei
Please help ASAP!!!! 100 points!
The transtheoretical model includes a stage called termination. a. True b. False
1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m
Which factor played a role in the sudden drop after 1928? A. Lack of demand B. Lack of supply C. Lack of credit D. Lack of income