fvgvyujhvhjgghvght44 fvgvyujhvhjgghvght44

11-03-2021
SAT

contestada

consumers believe that the market price of laptops will decrease in the coming months. right now, this will :

1. increase the demand for laptops
2. decrease the demand for laptops
3. decrease the supply of laptops

Respuesta :

noeliaxsilva noeliaxsilva

11-03-2021

Answer:

2 not sure

Explanation:

Answer Link

Otras preguntas

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Read “ Hope “ by Emily Dickson. Which them is best supported by the poem? Hope is not useful when someone faces challenges. Hope is not an emotion that people u

solve the system of equations x+y=6 and y+3x=4

Solve for missing value

what are the male reproductive parts of a flower ?

Which prism has the largest surface area?

2. What is the value of x? (y + 2.3) cm K G 7 cm (2.5x) H A. O 60 B. O 72 C.O 30 D.O 24

In Flanders fields how does the mood of the poem contribute to its meaning In Flanders fields the poppies blow Between the crosses, row on row, That mark our pl

Monique and Tara each make an ice-cream sundae. Monique gets 2 scoops of Cherry ice-cream and 1 scoop of Mint Chocolate Chunk ice-cream for a total of 71 g of f

b) 1325÷13 long division