aguilaranadalay aguilaranadalay

11-03-2021
History

contestada

In which year did the United States land an astronaunt on the surface of the moon

Respuesta :

Аноним Аноним

11-03-2021

Answer:

1969

Explanation:

Answer Link

kaiwinter200350 kaiwinter200350

11-03-2021

Answer:

July 20th 1969

Explanation:

In 1969 Commander Neil A. Armstrong and the men of Apollo 11 landed on the surface of the moon

Answer Link

Otras preguntas

PLZZZZZZZZ HELP MEEEEEE ....... Which sequences are arithmetic? Check all that apply. 0, 8, 16, 24 7, 12, 17, 22, 6, 12, 24, 48 8, 14, 20, 26 11, 18, 23, 30 12,

First one that knows the answer wins brainliest

Name the coordinates of the points on the graph. F _____ G_____ H_____ M_____ P_____

Which of the Following Best Completes The Graphic Organizer above? A. TortB. HomicideC. Assault D. Criminal

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA

A new car is purchased for $17,000 the value of the car depreciates at 12.25% per year what will the value of the car be to the nearest cent after 14 years

HELP ASAP SIMPLE MATH PROBLEM!!! WILL MARK BRAINLIEST! (please leave explanation too <3 )

True or false Long sounds are not harmful to humans

List 3 similarities and differences culture between lebanon and india

Long Construction Company uses the percentage-of-completion method of accounting for long-term construction contracts. During 2021, Long began work on a $400 mi