mavisabesi mavisabesi

04-04-2021
English

contestada

what is the suffix of convert that makes it a noun

Respuesta :

matthewoduola matthewoduola

04-04-2021

Answer:

-ion

Explanation:

Adding suffix -ion to convert becomes conversion which is a noun. Although in this case the 't' would change to 's'

Answer Link

Otras preguntas

IXL Please Help Fast!

< GRADES / 2022 RATIOS AND PROPORTIONS UNIT TEST Q21 21 What percent represents the shaded part of the hundredths grid shown?

an electric skateboarder is travelling west on a path along the river at 5m/s. A brisk walker on the other side of the riverbank is walking east along a path at

Why is it important to start seeing native Americans as “present day people”?

e trigonometry to work out the size of angle x.

Which of the following neighborhood facilities is most likely to improve residents' physical fitness?

There are 240 boxes with 25 bags of coffee each. I’d each bag weighs 0.62kg, what is the total weight of all the coffee? Round your answer to the nearest whole

What season is occurring in the NORTHERN HEMISPHERE in position #4?

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Which would NOT be the best stance to take when writing an opinion essay? What is the one most important room in the house? A: My bedroom. This is where I can g