RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Respuesta :

officialscripture officialscripture

14-04-2021

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Answer Link

Otras preguntas

35 points please help High Scalers Bureau of Reclamation (excerpt) Millions of years of weather[ing] [had] eroded the canyon walls [where the Hoover Dam was to

Which of the following levels of ecological organization is arranged in the correct sequence from most to least inclusive? A) community, ecosystem, individual,

If the statement can be proven to be true and cannot be proven false, then it is a(n) _______.

A map has a scale of 4 inches : 25 inches. How far are two cities on a map if they are 120 miles apart?

Instructions Conjuguez les verbes entre parenthèses ou laissez-les à l'infinitif. MATTHIEU Tu as raison. Ce sera très agréable. Il faut __________ (aller) LISE

What is the theme in Hymn to the Nile?

culinary arts complete the sentence that explains the difference between the cooking techniques.The difference between baking and broiling is _____________ . Th

What does the use of the figurative language “like a pack of wolves” tell the reader about how hungry the boys are?

11-2e+2+7e combining

The blitz left blackened ruins in this british city