RamenDonkey
RamenDonkey RamenDonkey
  • 14-04-2021
  • Biology
contestada

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Respuesta :

officialscripture
officialscripture officialscripture
  • 14-04-2021

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Answer Link

Otras preguntas

87.8 + 27.2 + 17.3 = ?​
Please help this has to be done soon
your answer is 36. create an equation using the values a=0,b=1,c=2,d=3,e=4,f=5,g=6,h=7,k=8,l=9,m=10,n=11
how do you do this omg
What is the final step in conducting a competitive audit? (UX) Outline the goals Create a list of your competitors Summarize your findings Research each product
why is it that my question is never answered?
state 4 conditions necessary for economic growth and high productivity​
Pls help 11% of 57 =39% of 28 =8% of 97 =6% of 24.4 =77% of 9.2 =​
the length of a rectangle is 5 feet longer than the width if the perimeter is 94 feet find the length and width of the rectangle
In September 2016, the cost of gasoline in Berlin was around 1.29 euros per liter. What would the equivalent cost be in U.S. dollars per gallon? 1 U.S. dollar ≈