Seudónimo Seudónimo

04-05-2021
Mathematics

contestada

again plssssssssssssssssssssssssssssssssssssssssss

again plssssssssssssssssssssssssssssssssssssssssss class=

Respuesta :

haydencurry haydencurry

04-05-2021

Answer:

C. [tex]y=5x+620[/tex]

Step-by-step explanation:

Answer Link

amber692 amber692

04-05-2021

The answer is C. y = 5x +620

Answer Link

Otras preguntas

An important change in the american family in the nineteenth century was

A rectangular garden is 9 feet long and 3 feet wide. A second rectangular garden has dimensions that are triple the dimensions of the first garden. What is the

Jill is interested in understanding the theory that focuses on power in contemporary society. what theory should jill investigate?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

1. use the graph of y = sin θ to find the value of sin θ for each value of θ. 270°please help

What was the main idea of Rousseau's famous work "The Social Contract".

If a family has three children, what is the probability that the family has at least one girl?

what are good websites to study for biology?

Which of the following was a territory the United States took from Spain after the Spanish–American War? A. Puerto Rico B. Hawaii C. Cuba D.

If abcd is a trapezoid with bases ab and dc. if ab=20, bc = 30, cd = 48, and ad =26, find the height of the trapezoid