mylesbeard24 mylesbeard24
  • 04-05-2021
  • Mathematics
contestada

[tex]8 ^(x)+32 x^{2}+4[/tex]

Respuesta :

jcherry99
jcherry99 jcherry99
  • 05-05-2021

Answer:

Step-by-step explanation:

Rearrange the terms and take out a common factor of 4

4(8x^2 + 2x + 1)

I think this is as far down as you want to take it. It gives an imaginary root which you may not be familiar with.

Answer Link

Otras preguntas

What is the best color In LED lights for when your sad
24) The cost in millions of dollars for a company to manufacture x thousand automobiles is given by the function C(x) = 3x^2 - 30x + 200. Find the number of aut
The radius of a hula hoop is 15in what is the area of a hula hoop in terms of pi
10. A ve B iki küme olmak üzere; S(A\B)-3, s(B\A)=8, s(AUB) = 14 olduğuna göre, (An B) kümesinin alt kümelerinin sayısı kaçtır?
I need help with this please help me
Solve for g. l= gT2 47² What is g equal to? g=1²2 g=4771 g=47²lT2 g=47
What is catenation???​
Find the requested function. 44) Find the polynomial function with leading coefficient 5; degree 4; and -4, 5, 2, and -7 as zeros. A) f(x)=5x(x + 4)(x - 5)(x-2)
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
The penguins at the zoo eat 2 5/8 pounds of fish each day. The zookeeper bought 5 1/4 pounds of fish. How many days will the fish last?