0630897 0630897
  • 14-05-2021
  • Mathematics
contestada

-11 2/3 x (-4 1/5) =

11 23 x 4 15 class=

Respuesta :

LinethH14
LinethH14 LinethH14
  • 14-05-2021

Answer:

49 is your answer :)

Step-by-step explanation:

Have a nice dayyy <3

Answer Link

Otras preguntas

Draw the orbital diagram for each of the following metals: a) [MoCl6]3− b) [Ni(H2O)6]2+(assume water is weak-field) c) [MnCl6]4−
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
Can someone help me out
Select all the correct answers. Which term describes the process of review of the software product? unit testing walkthrough user acceptance testing product ins
1.A thin metal disk with circle shaped is burn and its radius expands at rate 0.01 cm/second. When the radius is 50 cm, find the rate of change of surface area
What is the mass in grams of aluminum iodide that would be required to yield an actual amount of 80.25 grams of aluminum?
Find the product -20 • (-4) =
How do I solve this?
What is the percentage
What are some EXTERNAL factors for the fall of Rome ?