onyikeinnocent
onyikeinnocent onyikeinnocent
  • 15-06-2021
  • Mathematics
contestada

sketch a graph of f(x) = 2 + x​

Respuesta :

tittlequack tittlequack
  • 15-06-2021

Answer:

i don't have any paper by me but it would be the line starting on 2 on the Y axis (line that goes up and down) and then going diagonal by one square (essentially up one unit and right one unit)

Step-by-step explanation:

2+x is basically x+2

since x is by itself in slope form is represents 1/1 as a fraction, and in slope form 2 represents the Y axis

did my best to explain sorry hope this helped!!

Answer Link

Otras preguntas

The right to a trial by jury in a criminal case is outlined in which amendment?
Some puritans wanted to separate from the Church of England
Which one of the following choices best represents an appropriate warm-up exercise? A. Toe touches B. Supine leg lifts C. Hip extensions
The reason why vanessa did not include sports skills activities in her program was that she:
Please explain to me how to solve this
What is the solution to the equation ? n = −1 n = 2 n = 5/3 n = 5/2
PLEASE HELP ME ASAP Identify the area of the polygon with vertices P (1, 2), Q (1, 4), R (−1, 6), and S (−3, 2).
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
What was OPEC protesting when it imposed it's embargo?
which is a reason that protists are difficult to classify