edithmar6215 edithmar6215

04-07-2021
Business

contestada

If $240,000 is invested today and returns $432,000 in 10 years, what formula can be used to calculate the interest rate

Respuesta :

05-07-2021

Answer:

r = (FV/PV)^(1/n) – 1

and

Interest is 6.05 %

Explanation:

Interest is calculated as :

r = (FV/PV)^(1/n) – 1

Thus,

The formula that can be used to calculate the interest rate is

r = ($432,000/$240,000)^(1/10) – 1

= 6.05 %

Answer Link

Otras preguntas

Why are people who go to strip clubs generally NOT considered to be voyeurs? Group of answer choices The nudity of the performers is not complete. There is no s

what is tariffwhat is tariff

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

add h and 6, then subtract 2 from the result

Can somebody plz help answer these questions correctly (only if u done this before) thx sm! WILL MARK BRAINLIEST WHOEVER ANSWERS THESE FIRET :DDDD!

Przelicz temperatury: a) - 20 oC = ? K b) 45 oC = ? K c ) 223 K = ? oC d) 410 K = ? oC e) 55 oC = ? o F f ) 30 oC = ? o F g) 59 o F = ? oC

an someone tell me the steps in solving 5b - 6 = 24?

solve the equation below 4(ax + 3) -3ax = 25 + 3.

Use the galvanometers to determine the amount and direction of the induced current. Which galvanometer is indicating a current of 4 mA?

What’s the answer to question 1,2,3,4?