shraddhaphuyal51 shraddhaphuyal51

01-09-2021
English

contestada

Health is the most valuable property give reason?

Respuesta :

neharikagupta2020 neharikagupta2020

01-09-2021

explanation = hope this answer will help you

Ver imagen neharikagupta2020

Answer Link

Otras preguntas

Complete the sentence about a focusing technique. Subjects with a lot of _______ make focusing easier.

According to the article, what are three ways to drink responsibly?

Select the correct verb or -ir in the sentence below: "Mis amigos ____a la playa" van voy va

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTA

Round 10,982 to the nearest thousand

11 more than five of a certain number is twenty more than 2 times of that number. what is the number?

PLEASE HURRY I'M BEING TIMED!

2+2 also include a paragraph about how awesome i am and i will brainlest ( winners will be picked tommorw)

reduce the ratio to its lowest form 18:81

plz help One real-world problem that is solved by an equation James has twin sisters (who are the same age, of course). James is 12. If the combined ages of Jam