noway29 noway29
  • 01-10-2021
  • Biology
contestada

The power of DNA????

Respuesta :

kaitslifeway kaitslifeway
  • 01-10-2021
The DNA controls every cell process and the ways in which our cells communicate and work together creating our unique individual design. The same DNA is within every cell in our body.
Answer Link

Otras preguntas

17. How did the Zimmerman note influence the American government's decision to enter the war on the side of the Allied forces?
Which of the following statements correctly summarizes the steps of protein synthesis? Transcription & Translationa.) mRNA copies DNA into an amino acid cha
Constructive interference in wave patterns causes an increase in which measurement associated with waves and vibrations? A. period B. frequency C. speed D. ampl
Please, my whole grade depends on this question!!!
A box at the post office has dimensions as shown below. A rectangular prism with a length of 12 inches, width of 8 inches, and height of 16 inches. What is the
Please I need help, please describe the following images
please help!!! i’ll mark as brainliest!! what is the type of system where a furnace burns fuel and heats air? a. radiation system b. forced - heat - system c.
Please help. I can't seem to solve this problem.
To say that a vote is worth more in one district than in another would not only run counter to our fundamental ideas of democratic government, it would cast asi
what is the complementary DNA of TACCGGATGCCAGATCAAATC?