hiisjxnffjska hiisjxnffjska
  • 11-10-2021
  • English
contestada

Can someone help me with this homework? :(

Can someone help me with this homework class=

Respuesta :

nehemiahholley39
nehemiahholley39 nehemiahholley39
  • 15-10-2021

Answer:

Explanation: Consciuous meaning it still like about water and water has not touched it yet, Preconscious meaning that it is under water but not all the way under water and Unconscious means its fully submerged in the water and its will not float back up

Answer Link

Otras preguntas

PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
▪ Discuss demographic developments (population trends) in Western Europe during the Early Middle Ages PLEASE ANSWER!!! I HAVE MS. LYONS NEXT PERIOD!!!
What happens to energy as you move up food chain
Which organisms accomplish most of the work of converting atmospheric nitrogen into a form usable to green plants?
Which statements best describe gases? Check all that apply. The atoms in a gas move at high speeds. The atoms in a gas often get stuck together. The atoms in a
what are preventions of human papilloma virus
During the time that the metamorphosis was written which part of gregor' s life would have been considered commonplace?
the area of a rectangular photograph is 35 square inches if the width of the photo is 5 inches how tall is the photo
Write the equation of the line below in slope intercept form.
What part of Africa is the Ghana empire located