cljordF8loriole cljordF8loriole
  • 03-01-2017
  • Mathematics
contestada

If a car gets 42.1 mpg on the highway, how many gallons of fuel will it use by traveling 340 highway miles? (round answer to tenths)

Respuesta :

Аноним Аноним
  • 03-01-2017
For 1 gallon of fuel, car travels = 42.1 miles
Then, for 340 miles, it will need = 340 / 42.1 = 8.076 gallon

After rounding-off to the nearest tenth it will be 8.1 gallons.

In short, final answer of your question would be 8.1 gallons

Hope this helps!
Answer Link

Otras preguntas

Where did middle names come from
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
4(3-5)=-2(8-z)-6z what is z
On a map, the distance between two cities is 7.3 centimeters. The map scale is 1 cm:50 km. What is the actual distance between the two cities?
the perimeter of a square 116ft ?
What statement best describes a republic?
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
Solve 2x2 - 8x = -7 Which of the following is a solution of x2 + 5x = -2?
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5