spicychicken574 spicychicken574

04-11-2021
Mathematics

contestada

simplify this expression 5r + 3 - r + s - 3s.

Respuesta :

alyssam4444 alyssam4444

04-11-2021

Answer:

4r -2s+3

Step-by-step explanation:

Answer Link

Otras preguntas

17. alcohol is the number one drug problem in america? true or false ?

Determine 6th term in the geometric sequence whose first term is 3 and whose common ratio is -4.

triangle ABC is similar to Triangle d e f if the perimeter of a triangle ABC is 24 in what is the perimeter of triangle d e f a b c has one length of 9 inches a

Why did the radio broadcast of the war of the worlds include an orchestra and musical breaks a create pathos to get audience attention and draw them close to th

What does the text say that the primary advantage of the north over the south was?

The sale price of an item is $180 after a 25% discount is applied. What is the original price of the item

If a cell is placed inside a solution that has a higher concentration of solute than on the inside of the cell, what can be said about the movement of water?

Normal hemoglobin DNA - cacgtggactgaggactcctc What is the normal hemoglodin acid- Normal hemoglobin A.A sequnce For figuring out RNA A binds with U C binds

Explain how obesity could be viewed as both a personal problem and a social problem.

According to Thoreau, how can a minority exercise power?