pichputhearit pichputhearit
  • 01-12-2021
  • Mathematics
contestada

Find the value of x and thank

Find the value of x and thank class=

Respuesta :

Lyricalcosplays Lyricalcosplays
  • 01-12-2021
80°

Explanation: ……………
Answer Link
sophiamf110505
sophiamf110505 sophiamf110505
  • 01-12-2021

Answer:

65

Step-by-step explanation:

180-100 (40+60) =80

80+35= 115

180-115=65

Answer Link

Otras preguntas

What was the primary mission of the Lewis and Clark Expedition?Remove Native Americans from Louisiana.Explore and map the Louisiana Purchase.Find a route to the
How did the use of landmines and fragmentation bombs make the war especially brutal for soldiers and civilians?
Match the genes with their linkage ability.
PLZZZZZZZ help find mRNA and A.A sequnce to this Sickle cell hemoglobin DNA- cacgtggactgaggacacctc Sickle cells hemglobin mRNA- Sickle Cell shemoglobin A.A se
Velocity is a vector quantity which has both magnitude and direction. ... Net force is also a vector quantity which has both magnitude and direction. Using comp
Which tasks are typical for someone working in buying and merchandising
Which side of XYZ is the longest ?? Please Help
Calculate the percent activity of the radioactive isotope iodine-131 remaining after 3 half-lives.
A private plane is traveling due east at a rate of 160 mph. A south wind is blowing 30 mph. What is the actual velocity of the plane? A. ≈ 157 mph B. ≈ 190 mph
Why did Palmer arrest thousands of people and deport them between 1919-1920