Yuuzan Yuuzan
  • 03-03-2022
  • Mathematics
contestada

please help the question is in attacahemnt

please help the question is in attacahemnt class=

Respuesta :

Chem2929 Chem2929
  • 04-03-2022

Answer:

ravi will have 100,000

Rani will have 150,000

Step-by-step explanation:

Answer Link

Otras preguntas

a pine tree measured 40 and 1 over 2 feet tall. Over the next 7 and 1 over 2 years it grew to a height of 57 feet. During the 7 and 1 over 2 years, what was the
2ln(5x)=8 solve for x
what is the position of 9 in the number 932,805? A. The ten-thousands place B. The hundred-thousands place C. The hundreds place D. The ones place
The section of the small intestine between the duodenum and ilium?
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Do all your pet's offspring look the same? If no, then explain why they look different.
How do you put allele in a sentence
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what are the 2 major types of cofactors?