Seudónimo Seudónimo

12-04-2022
French

contestada

Spider in French is araignée, but is that feminine or masculine?

Respuesta :

tgxcpv9896 tgxcpv9896

12-04-2022

I believe it is a feminine noun

Answer Link

Аноним Аноним

18-04-2022

Answer:

Feminine

Explanation:

The word spider in French is feminine.

I hope it helps! Have a great day!

Muffin~

Answer Link

Otras preguntas

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

hitunglah luas daerah yang diwarnai pada gambar diatas plis pke caraa

Write a question that the database will understand. Which records are more than one thousand? >1000 O >=100 O <1000 O <>1000

Some one help with my essay I’ve been stuck for a week

Please help I was sick and missed out on class.Thank you

b) An aeroplane has 40 seats for passengers. Passengers travelling in economy class can take 20 kgs of baggage each and business class can take 60 kgs of baggag

Applications of Electromagnetism Project: Graphing Relationships 100 POINTS!!!!! ASSIGNMENT SUMMARY In this assignment, you will review some student lab result

need help with starting a gun law argumentative essay

Find the cross-sectional area

From The Adventures of Tom Sawyer by Mark Twain Tom was a trifle disconcerted. The basin was refilled, and this time he stood over it a little while, gathering