thatonechild thatonechild

15-07-2022
Biology

contestada

What is the replicated DNA sequence for GGC GAG AAT GAA ACT ATT TGT AGC

Respuesta :

ariahuds8154 ariahuds8154

15-07-2022

Answer:

ccgctcttactttgataaacatcg

Answer Link

Otras preguntas

Find the slope of the line with these two points: (2,5) and (4, 10).

Alvin is saving $1,500 for a down payment on a car. He has saved $300 so far and plans to save the rest in 6 months. How much money does he need to save per mon

Multiples of 7 between 20 and 40

5 pockets of potatoes R125,00. how much will 4 pockets cost?

A fictional story of a teacher and the spirit of a Hessian soldier from the American Revolution. A narrative primarily set in the New York wildemess during the

How were people treated differently under the Mauryas and the Guptas?

Each month, your phone company charges you a fee of 15 cents per minute as well as a service fee of $3.95. Write a linear function rule that models the number o

please helpp!! The exponential function f(x) has a horizontal asymptote at y = 3. What is the end behavior of f(x)? A. As x decreases, f(x) approaches, but ne

Happy Tuesday peeps brainliest and 5 star rating!!!!!!!!!!!!!!!!!

Same-side interior angles in a parallelogram are congruent Always True Sometimes True Never True