jorih23 jorih23
  • 12-02-2017
  • Arts
contestada

What does it mean when cadences are elided?

Respuesta :

tasha60
tasha60 tasha60
  • 12-02-2017
the new phrase begins simultaneously with,or before, the cadence chord of the first phrase
Answer Link

Otras preguntas

1. Prezinta algoritmii de caracterizare a unui publicistic 2. Explica ın enunturi prezenta şi rolul personajului ın tectul literar şi non-literar. Numeşte domi
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
can someone please tell me the answer to theses 2 questions
A little over __________ of all employees now work more than 40 hours per week.
is the world a good or bad place (explain and support your opinion)
Outlining is the first step in writing an essay answer. It is true not false
What is the main idea of this paragraph? A robot's job isn't limited to the terrestrial level, either. Even in space, machines such as the R2 humanoid robot at
How was the textile industry most improved? An influx of able workers Increase of raw materials New technology New management techniques
What is the perimeter of this rectangle? A. 21 in. B. 32 in. C. 42 in. D. 52 in.
Please help me please