Rooroo312 Rooroo312

03-03-2017
Mathematics

contestada

What's the largest 5-digit number that is a multiple of both 4 and 9? Thanks for the help;)

Respuesta :

Аноним Аноним

03-03-2017

99972
This is the answer, young padawan

Answer Link

Аноним Аноним

03-03-2017

NO I WAS JUST TYPING IN 99972

Answer Link

Otras preguntas

HELP find the solution set of the inequality 15x-4 < 29.

How did Mikhail Gorbachev's policy of glasnost contribute to the collapse of the Soviet Union? A. The policy of glasnost led to food shortages and extreme infla

Evaluate the challenges engineers face in the process of developing artificial photosynthesis.

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

Sleep is a essential part of life

Joe needs to push his car 20 feet up a hill. If he applies a 50-pound horizontal force to move the car at an angle 30° above the car's horizontal axis, how muc

The lengths of two sides of a right triangle are given. Find the length of the third side. Round to the nearest tenth if necessary. legs: 28 in. and 15 in. I ne

how should we respond to an attack from our enemy at a boarder?

(The Outsiders Chapter 3-4 ) 5.In a fight at the water fountain, Johnny Killed Bob with a knife Ran for help Was the first to see the policeman Accidentally lef

fill in the blanks Banks take money that is unused by ___________ and lend it to people who want to ___________ or buy things that they can’t immediately afford