Bzl4il8colecro Bzl4il8colecro

01-05-2017
Health

contestada

Which types of wound are normally small, produce little or no bleeding and can be easily overlooked??

Respuesta :

bjneptune bjneptune

01-05-2017

I think they are called flesh wounds if not probably a scar.

Answer Link

Otras preguntas

Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.

Somebody asked a teacher: ”How many students do you have? I would like to send my son to your school.” The teacher answered: “If as many students as I have now

Which of the following shows the graph of y=In(-2x)

Arrange the complex numbers in order according to the quadrant in which they appear, starting with the first quadrant. Tiles: 3 − 4i -1 − 3i 4 + i -2 + 2i

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

For hundreds of years before India’s independence from Great Britain, Hindus and Muslims had been A.independent B.peaceful C.separate D.hostile

A federal program that guarantees benefits to qualified recipients is a(n) ________ program

Solve for x. Assume that lines which appear tangent are tangent.

What happens when energy is changed from one form to another? a. a physical change to a substance occurs. b. all of the energy can be accounted for. c. all of t

HELP ASAP!! Which United States' president, in addition to Eisenhower, believed the federal government should play a smaller role in the economy? A) Ford B) Ca