kgarci6204 kgarci6204

15-06-2017
Chemistry

contestada

In which type of chemical reaction is heat absorbed from the surroundings?

Respuesta :

annieslove4paws annieslove4paws

15-06-2017

it would be an endothermic reaction if heat is getting absorbed. If heat is leaving it would be an exothermic reaction

Answer Link

Otras preguntas

What is the organizational structure of Maryland and who can participate?

On November 2, Sheffield Company discounted at Sunshine Bank a $5,760 (maturity value), 129-day note dated August 15. Sunshine's discount rate was 7%. (Use Days

what are some examples of achieving your educational and career goals with a medical assistant?

Search and write the source material pertaining to the Mughals and history from the Muslim conquest of India up to the Mughal emperor Muhammad Shah.

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Selective breeding is a process in which humans choose the genetic traits they want in the offspring of a plant or an animal. Parent organisms with the desired

find the annual salary of a person who is paid $835.50 per week

Drag the tiles to the correct boxes to complete the pairs . Match the description of each plant with the group to which the plant belongs

3) Consider the ideal gas equation, PV = nRT. Rearrange to solve for P (show your work below). Recall that the equation of a line is y = mx + b. In that case, p

what describes assimilation of heteronormative ideals into gay lesbian queer culture