sjpbvvxfjt sjpbvvxfjt

14-04-2024
Chemistry

contestada

What are the attractive forces between ammonium and acetate

Respuesta :

dariathecaci dariathecaci

14-04-2024

The attractive forces between ammonium and acetate include ion-dipole interactions, hydrogen bonding, and dispersion forces.

Answer Link

Otras preguntas

Graph g(x) = −2x − 8 and identify its x-intercept. (−8, 0) (−4, 0) (0, −4) (0, −8)

does anybody know how to answer this, and what I should look up to find out how to do this

Examine these citations for hypothetical books about the Roman Empire: • Barriston, Josh. Economics of the Roman Empire. Free Press Publishing, 1832. ● • Jamiso

What is the slope of a line parallel to the line 3x - 2y = 8?

PLEASE HELPP!! IM TIMED!! ill give brainliest <3{it is not A}Analyze the set below and answer the question that follows.Which Venn diagram has shading that r

According to the dependency model, what historical, social and economic circumstances led to the current unequal world system? Question 2 (Mandatory) (10 points

If a person's eye level is h meters above sea level and he can see d kilometers to the horizon, then d=3.6√/h. Suppose the person can see 9.9 kilometers to the

(b) An element X forms a bromide that is a liquid at room temperature and that has the formula XBr3. Neither the element nor its bromide conducts electricity.

what is movement in geography??

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated