raymondjones5050 raymondjones5050
  • 15-09-2017
  • Biology
contestada

In which phase (state) do most earth materials have their greatest density?

Respuesta :

montanariana00owb42h montanariana00owb42h
  • 15-09-2017
solid-
As a volume of air expands due to heating, the density of this air will remain the same
Answer Link
rico37 rico37
  • 15-09-2017
The solid phase.Water is an exception.Also some materials has more than one solid phase, such as carbon which has different structures and therefore different densities for graphic as opposed to diamond.
Answer Link

Otras preguntas

A vehicle is only 15% efficient. What happened to the other 85%?
A light bulb converts electrical energy into electromagnetic energy is true or false?
In the years preceding World War I A)world tensions declined. B)military expenditures decreased. C)imperialistic ambitions seemed to decline. D)there was a s
What is the primary purpose of the Supremacy Clause?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?