buckcommander1922 buckcommander1922

11-10-2017
Health

contestada

Insulin leaves a pancreas cell by _ and delivers its message to a target cell by ___.

Respuesta :

redneckrob99 redneckrob99

11-10-2017

Insulin is secreted into the bloodstream and flows to its target cell the liver.

Answer Link

Otras preguntas

What number is 22% if 320

How are the civil service system and the merit system connected?

2.456 rounded to the nearest tenth

Find the value of X. if necessary round to the nearest tenth the figure is not drawn to scale

If solar radiation is 1040 w/m^2, how many photons strike the leaf every second? assume three significant figures and an average wavelength of 504 nm for solar

brainliesttt asasp :))))

Which of the following could be deductions from wages or salary? State taxes Overtime pay Federal taxes Benefits Payments for investments

Which of the following statements about Turkey is not true? The legal system is based on European laws. Women in Turkey have very few political or legal rights

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

Classify the triangle by its sides. •Equilateral •Scalene •Isosceles