Mhabeb4451 Mhabeb4451

12-01-2018
Arts

contestada

One of the most prominent feature/s of any greek building is its _____________.

Respuesta :

ahlanmohamed98 ahlanmohamed98

12-01-2018

100% sure its Columns

Answer Link

perseverence1 perseverence1

14-01-2018

The answer would be columns, particularly those of Doric or Ionic type, as the Greeks did invent the Corinthian column but rarely used it, it was mostly used by the Romans

Answer Link

Otras preguntas

Tell whether the relation, represented by the ordered pairs below, represents a function. Explain. { (-2, 4), (-1, 3), (0, 2), (-2, 0), (1, 1)

Given the polynomial equation: x^3-7x^2-x+7=0 1. Make a list of possible rational roots 2. Test the possible roots until you find one that produces a reminder

AP CSPThe cost of a customer’s electricity bill is based on the number of units of electricity the customer uses.For the first 25 units of electricity, the cost

From The Adventures of Tom Sawyer by Mark Twain Tom was a trifle disconcerted. The basin was refilled, and this time he stood over it a little while, gathering

Make the subject of 6x = t

What would be the sequence of nucleotides made from GCTATG

Question 4 (1 point) How many oxygens are present on the reactants side of this equation? KCIO3 --> KCI + O₂ 01 5 3 2

mary invests 12500 in savings rate of 1.5 percent for 2 years

Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG

Find the inverse of f(x) = 1/ x + 8