rajene2737 rajene2737
  • 13-03-2018
  • World Languages
contestada

How to say it’s teribbly cold in Beijing in chinese traditional?

Respuesta :

ellagrace14
ellagrace14 ellagrace14
  • 13-03-2018
Tā fēicháng hánlěng. hope that helps!! if you have any questions about the answer that i gave you make sure that you let me know and i will be happy to figure out my mistake!! if you have any concerns make sure to let me know as well!!!! thank you!!!
Answer Link

Otras preguntas

What is the complementary DNA strand for the DNA strand AATTGGCCATGCATGATTACGA
please help me with this
On the day of his 18th birthday he started saving money regularly .Starting on that day he Could save £30 on the same date every month' how much he have saved b
Owners of the restaurant in A. anticipate that in one year their demand will double as long as they can provide good service to their customers. How much will t
plss help Which of these is a primary governmental authority for carrying out laws in cities? A) Commissioner Eliminate B) Governor C) Judge D) Mayor
Identify the parts of this sentence. The umbilical cord links the baby to its mama.
A professor has 24 pairs of socks in his drawer. 18 pairs are black and the rest are brown. He always wears black pants. He does not pay much attention to which
These box plots show daily low temperatures for a sample of days in two different towns.
Evaluate the expression for m = –1. –21m2 − 11m − 30 =
A spring with spring constant of 33 N/m is stretched 0.15 m from its equilibrium position. How much work must be done to stretch it an additional 0.072 m? 1. 0.