wilmermartineza wilmermartineza
  • 03-05-2018
  • Physics
contestada

Chalk and talc are insoluble. what do you think thus term means

Respuesta :

Raunak05
Raunak05 Raunak05
  • 03-05-2018
When the term insoluble is used in general, it usually refers to solubility in water.
Thus this means that chalk and talcum powder, both , are not soluble in water.
When these two are are soluble in other solvents, the solvent is specified.
Hope this helps. :)
Answer Link

Otras preguntas

how to i do 7/16÷(31/2÷1/2)
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
I want to work with LDAP. what is LDAP?
round 7,782 to the nearest hundred
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
When 40 is added to the number of miles Karen ran last week, the result is the same as adding 10 to 4 times the number of miles she ran last week. How many mile
Do all your pet's offspring look the same? If no, then explain why they look different.
the temperature of a sample of matter is a measure of the ?
A flatbed truck is loaded 7,000 pounds of bricks. How many tons of bricks are on the truck?
how do you know 8 thousandths is less than 1 hundredths