willcoop7219 willcoop7219
  • 03-09-2019
  • Social Studies
contestada

The system of standardized parts made possible the replacing of broken or worn parts instead of replacing the whole product.
True / False.

Respuesta :

nuuk nuuk
  • 09-09-2019

Answer:True

Explanation:

Standardization parts made possible the replacing of broken or worn parts instead of replacing the whole product.Standardization reduces the cost and and speed up the whole process by replacing only a part of the machine.

Standardization made the products of the desired dimension in variables units such  that  it can be easily accessible.

Answer Link

Otras preguntas

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAAT
ANSWER THE QUESTION FOR BRAINLIEST
Find the missing measure in each triangle. 56 63 a. 51 b. 61 c. 65 d. 119
Hurry!!! Timed!! Do NOT answer with a link!!!Which statements describe gene therapy? Check all that apply. A. It cures all cases of cystic fibrosis. B. It invo
Simple mathhh help please!!
What is the distance from (3.5 ,5) to (3.5, -12) 17 7
How was John C. Fremont different from other explorers
HELP ASAP PLS ANSWER AS MANY AS YOU CAN Q1: Long dry seasons and cyclones in Southeast Asia are two severe weather conditions that impact _______. A. Manufactur
Find the value of x. Can someone help please?
I need someone to find the one subject and verb in each sentence, appreciate it (I’ll reward points + brainalist)