sharaicalixte4567 sharaicalixte4567

14-09-2020
Mathematics

contestada

How do i solve this im confused

How do i solve this im confused class=

Respuesta :

bmanduva8610 bmanduva8610

14-09-2020

Answer:

$3.35

Step-by-step explanation:

You will need to either solve alegrabically or graph the two equations. While graphing the point where both equations intersect would be the answer to your question.

Ver imagen bmanduva8610

Answer Link

Otras preguntas

What is equation of the line that is parallel to the line of the y-1=4(x+3) and passes through the the point (4,3)

Why does hazardous waste require special handling?

What are 2 examples of conservation efforts in the marine environment?

Equations must be written in the following format (using the number 20 as an example): Addition x + 20 = y; Subtraction x - 20 = y; Multiplication 20x=y; Divisi

which river was the first gold found in?

Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG

Why do we tell actor do break their legs?

2 x 6.9 - 4.6 + 1.3 =

Estimate the percent of the number. 66% of 41 Choose the correct answer below. A.28 B.21 C.37 D.33

Your grand opening flyer should be colorful with visuals that describe the services you provide filled with hard to read graphics vague with little information