lillybaker477 lillybaker477

04-01-2021
Mathematics

contestada

please help with this answer I don't understand it

please help with this answer I dont understand it class=

Respuesta :

glnnkemp glnnkemp

04-01-2021

Answer:

Step-by-step explanation:

the 1st one is 1735

The 2nd one is 1573

Answer Link

Otras preguntas

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC

The text describes the Muslim saint shrine of Husain Tekri and the rituals that pilgrims to this shrine participate in to venerate this long-deceased Muslim mar

I need on help on this!

In a class total of 65 students. 17 students failed the final exams. Write a statement to show the number of students that passed

8. What were the beliefs of the Quakers?

Can you Describe the three parts of an ATP mmolecule?

4.286-9.43 solve questions

Selected financial information for Baird Company for Year 4 follows: Sales $ 2,450,000 Cost of goods sold 1,715,000 Merchandise inventory Beginning of year 159,

a synonym for 14 points

The function f(t) represents the cost to connect to the Internet at an online gaming store. It is a function of t, the time in minutes spent on the Internet. f(