offoff77573 offoff77573

02-09-2021
History

contestada

What did the Mississippian Indians hunt/collect for food? Check all that
apply.

What did the Mississippian Indians huntcollect for food Check all that apply class=

Respuesta :

jakediamond jakediamond

02-09-2021

Answer:

The Mississippian Indians hunted/collected: deer, turtles, rabbit, muskrats, and fish. I'm not aware of any documents that have them hunting buffalo.

Answer Link

Otras preguntas

Two factors effecting the magnitude of the force of gravity between 2 objects are...

In triangleABC, C is the right angle. If tanA = 8/6, find cosB A. 6/8 B. 6/10 C. 8/10 D. Doesnt exist

Simplify. What is your answer 8x + 9d + 3x -5d A: 11x + 4d B: 11x + 14d C: 5x + 4d D: 15xd

slope (-3,0 2,0 3,4 )

In a classic experiment (Barker, Dembo, & Lewin, 1941) researchers prevented children from playing with attractive toys. Once the children gained access to

in interphase, the DNA is in the from of loose threads called?

A 3.5kg rock is raised to a height of 35m before it is dropped. What was the PE of the rockbefore it was dropped?

The Cooper Tire & Rubber Company has been searching for less expensive raw materials for manufacturing its bicycle tires. Cooper has found that there are l

Which graph represents the function ? f(x)= 3 if x < 1 x if x ≥ 1

I need to match the nitrogenous base with its complementary base pair from one strand: ATTGGCCATTGGAATACCAGTCGAGGCCACCGAGGCCTTAC