Jwes805 Jwes805

03-09-2017
History

contestada

What were the causes of the population decline in the early 14th century?

Respuesta :

thert68 thert68

04-09-2017

Climate change, the bubonic plague, and the 100 years war were causes of population decline in the early 14th century.

Answer Link

Otras preguntas

A tourist drops (from rest) a ping pong ball from the top of the tower, which has a height of 324 meters. Assuming no air resistance, how long does it

Find the percent. 2% of 4,050 tiles is ________ tiles. ASAP PLEASEEEEEE

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

(04.01 LC) Which of the following is a molecule with more than one element? O Atom O Bacteria Compound Organism

In kite ABCD, BE = –x + 6 and ED = 0.5x. Determine the value of x in the kite shown. Question 5 options: A) x = –12 B) x = –3 C) x = 4 D) x = 9

Al comenzar el cuento, ¿qué ha traído Ildara del campo? ¿Por qué lo necesita?

4. A stamp collector has some 15¢ stamps and some 20¢ stamps. The number of 15¢ stamps is eight less than three times the number of 20¢ stamps. The total value

What are the duties and responsibilities of the United States according to Roosevelt

A rectangle has a length of 12 inches has a perimeter of 38 inches. What is the missing side of the rectangle ? What is the area of the rectangle ?

Which of the following is true about serfs? Serfs were technically free, but were tied to the land they were born on. Serfs were allowed to travel with their lo